CBrugiaQ_2523


Sequence

>CBrugiaQ_2523 (32 EST) Length=792 GCGTTACACAGATGGTTGAGCAGCAGCTGGAGAAGCTATAAACAAAGCTTCATCCCCTTCACAACTTCGAATTTCAGTTT CAACATCGGCAGGCAATAATGGCGGAAGATATTGATGAGATTCTGGCTGAAATTGATGGCTCACAAATTGAGGAATATCA AAAGTTCTTCGACATGTTTGATCGTGGTAAACAGGGCTACATCATGGCAACACAAATTGGCCAGATTATGCATGCGATGG AACAAGACTTTGATGAAAAGCAACTTCGAAAGTTGATTCGTAAATTTGACGCTGATGGATCCGGAAAACTGGAGTTTGAT GAATTCTGTGCCCTCGTCTACACCGTTGCCAATACAGTCGATAAGGAGACATTGCAAAAGGAACTAAGAGAAGCTTTCCG ACTTTTTGACAAAGAGGGTAATGGTTATATATCTCGGCCAACCCTGAAAGCACTTCTGAAAGAAATTGCTGATGATCTGA GCGACGAACAGCTGGAAGCCGCTGTNGACGAAATAGATGAGGATGGTTCTGGAAAGATTGAATTTGAAGAATTTTGGGAA TTAATGGCCGGTGATGCTGACTGAACAATAACAGTTGACAATTTCTAACCTTTCTTTTTGAATTTAATTACTGGTACGAA AATCTGCCTATATTTATCGTTTGTTGTACTATATGTTATTATCAATGTTATAGAAATATTTTTAAGATATGAAATAAACA TTATTTAAATATAATTTAATAAACGATCGACTACGTGAAAAAAAAAAAAAAAAACCCCGGGGGGGGGCCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_2523: (32 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217585808407R47520SW3ICA015SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
291641902173H31017SW3ICA139SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
300509915167H39472SW3ICA312SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4385041158253N37111SW3ICA636SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4445581167359N43057SW3ICA1053SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4446091167410N43105SW3ICA940SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447251167622N43240SW3ICA676SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447651167662N43280SW3ICA749SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4450821182109N43644SW3ICA814SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4452031182230N43702SW3ICA734SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4811721237142N74833SW3ICA1367SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5304261300176W23322SW3ICA1451SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5304911300241W23387SWAMCA713SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7566241673249AA118200MBAFCE6D04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8640391845487AA224703SW3ICA2072SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8640441845492AA224708SW3ICA2078SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8962971889977AA255374SW3ICA2411SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8986261893231AA257728MBAFCZ3F7T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9245961926198AA283504SW3ICA2626SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10777282130911AA433434SW3ICA2669SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10777362130919AA433442SW3ICA2189SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10989252168095AA454426MBAFCX1E01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11938752315027AA547826MB3D6V1E04T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
11939612315113AA547912MB3D6V2F11T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
12355062369601AA585048SWMFCA2904SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12618432393039AA585627SW3D9CA350SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12618482393044AA585632SW3D9CA363SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12774482429590AA598338SWMFCA2968SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12774492429591AA598339SWMFCA2969SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13666622605200AA661156MB3D6V3D12T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13668462605384AA661340MB3D6V5H01T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13813942655514AA675808MBAFCW5A10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:7:18 on Thu 23 Nov 117.