CBrugiaQ_2537


Sequence

>CBrugiaQ_2537 (2 EST) Length=373 CAGTTTGAGCAATATCAAAGTTGCGATAAAACAACGAAAATGGCAAAGTTGATAGTGTATCTTGCTTTCATCATATATTG TAATCGGACAACAAAACGCTCAAGCAGCAACAAGATGCAAGCAATGGCAGCAGGAACAGCCGCTGAAGTTATCACAAATT ATAAAGCTGAAAAGTTATGGGAAGATGACTTACTAATGGAGACAAAACAAGTAGAAGAATCAACACTGACGAATTGTGAC ACAATGAAAGATGGAAGATTATTTGTTTTGGAAGAAAAACCGCTGTTATTGATGACAAATACTGTTAACTTGATGAAATG GAATTAGGAAAATGTAAATGTGCAATGTGCAAGTGATTAAATATCAATTGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_2537: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5771381378350W69050SWAMCA1001SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
12619262393122AA585710SW3D9CA506SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 0:36:58 on Sat 25 Nov 117.