CBrugiaQ_2542


Sequence

>CBrugiaQ_2542 (7 EST) Length=858 ACTTTTTAGTTTATTTGTCATACAAACATAGTAAATGAAATCAATGAATAAAGTTTTCGAATTAAAAATTTTTTGAAAGT TAGCGGTTAACGAGATAATTATTCATCATTAAGATCGCCAGTTGGTGCATCAAACGTTGCAGAACGTTTCCCGAAGCGTA TCATCATATCTGCTGGATTTGGNACACGTTTACCAATGTATGAATCACTTGGATTGAAATAATATCGCATTGGTTCGAAG CCACCTCTGAATAAATCACTGTCTTGTAATTGTTTAGAATCAGTGTTACCCGAAATGGTTAATAACAAGCAAAACTGCTA CGATTAATACTGTAAATGTAGAACATTGTGAAGTATAATAGGCCTCAAACTTGAGCCAATCTAAACCAGGAATTCGGCAA CTACGAGCAATATTCTTCACGCTTTTTAACGATTTACGACTGTTCTTTTTCAGCGTAACCGACACGCCCGACTTAGCAGG GAAAAAGGTTTTACCTCGCTTCTTCATTACCACTACAATGCCTTTACCATCAGATGTTGCCTGGATGTCCAAACCTTTTC TATGAACCAATCCATTGAAACGAATACTGTTAACACCTTTGATATTAAAACGTTCTCTGCTAAAATGTTTCGGGATTCCA CGTTGTCGACGCAGAAATGACGATGTCTTTCGAATAACCTGCCACTGAATATCGGCTGATACCATCACTGCCCAACTCTT CTCTGTTCACCTCAAACTTGCTCGTGCCGAATTCGGCACGAAGTAAAATCACCTCCTTGACACATGAATTCTGGAATAAC TCGATGAAATTTGCAATTTTTATAATGAAGTGGCTTTCCAAGTTTACCCATTCCTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_2542: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217695808517R47630AS3ISB025SLBrugia malayi infective L3 JHU93SL-BmL3
7092501613924AA074020SW3ICA1679SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7566191673244AA118195MBAFCE6C10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8001721737555AA161532MBAFCE9H02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196381763819AA180627MBAFCG1C08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8808611870845AA241457MBL2SJ0E5T3Brugia malayi second stage larvae JHU96SL-BmL2
8983871892992AA257321MBAFCZ0H5T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 12:3:57 on Fri 24 Nov 117.