CBrugiaQ_2546


Sequence

>CBrugiaQ_2546 (2 EST) Length=387 GACTGCACGAGTGAGTGATGAGATTGACCCTAACATGCATAATGTATCAGTGGTATATCAATACCGATAACTACTGCATT AAAAATGAAAAGTGTTGGAGTAAACGGAACTGTTAGGTGTGATGGCAAACCTGTAAATGACGCATTAATTGAGTGATACA GCGAAAGAAATGCTGGGAAATCAAATGCAGTACTTGCTGACAACAAAAACGAATGAGCAGGGTCATTTTATAATCAAAGG AAGCTCAAAAAAAGATACGTGGGATCCACAGTCCACCTATAAGTTCACAAATGTCGNTACATAAGCCTTTGCACCACGTN AAAGTTATTCCTTCCGTATTCCCCTGACAAAATATTTCACGCTCAGTTCACAGCCACATGAAATCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2546: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8390271795692AA199949SW3ICA1982SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8982871892892AA257253MB4SLM2F8T3Brugia malayi L4 JHU93SL-BmL4


Date: 21:52:59 on Mon 20 Nov 117.