CBrugiaQ_255


Sequence

>CBrugiaQ_255 (3 EST) Length=654 AGCGGATTGATAANTCCCNTNGAAGTTTAGGGAGCGATAGTGGGANGATGTATCACCTTGTCGCCCTGGGACATTTTTTT CATCANTTTGGGGGAACCTCAATTTTCAAACCATTGTCATCCAGTCCAGGATCACCAGGTACCGGTTTGAATAGATCCAC AAGCTGTATCGTGTAGAACAGTGTCTGTCCACTTCTTATATGATCTCNGTCTCGACCATCATCTCCGAAACCTAGATGTG CTGGGGATGACCAACTTTCTTCTTTTCACCGATACAACATACCGGTCATAGCACGGTCCATGCCACTGATAACTTGATTT TTACCAAGTGTAAATGAATATGGTTTCTTGCCGAAATTGGATCCTATCGTTTGTCCATCTGTATCAGAAAGTTTGTAGAA CTGTTCAACGATATCACCAGGTTGGCTTTTCACCTTACATTTCTCTGGCTTGATTGGTTTTATTATTTTAATCTCCAGTC CATCATTTTCCTTCCAACTGAGTTTCTCTTCGTCCTCACTGAATACAGATGCAAAGCATATTATTGTAGCGCCCACGATG AGAACTAATTTATTACAATGCATAGCTCAGAAAGAATTAAAATTGAGTTTCAGAAAAATTATAACCAGAGAAAACGAGGC AATAAGATTTNTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_255: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8001781737561AA161551MBAFCF1A02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8980961892701AA257173SWMFCA1457SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9246521927222AA283564SW3ICA2707SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 17:13:28 on Thu 23 Nov 117.