CBrugiaQ_2550


Sequence

>CBrugiaQ_2550 (4 EST) Length=458 GAATGTGGACGTACAGAAACCATAAACGGCTCGCTCTACTTCACCTAGTTAACTGTTGACTTTTGCATTGATCTTCATTC TTGGATTCATTTGTGGTAAAGGAAGTGTTGAAGATGCGCTTTTGTCTTTCTTTTTTCTTATCAGCTAGTTTTGAGCTATC CCATGTATCAATCGCCATTGCCGTGACAGATCTGTAGGCAATAACTTGGCCGTTTCTCTTGTATTTCATTTTCCCTTTGC TTGTATCAGTTTAATTTATAATTAGTTCCTCTTTGTAAACGATTTCTATATTTTTAATTTTCTAAGATAATACGGTTATT ATTTGACTTATTCTTTATGCACTCTGCTTGAATTGCCGTGTTTTTTTTTCTTGTTTTTTGGTTATATTAAGACCGTTTTA CTTAAAAGATTTTCATCCGTTGCAAAAATAAATATTTGAGAACGTCATGTTTCTCTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2550: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7061801592598AA072525SW3ICA1602SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8001821737565AA161555MBAFCF1A08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9076631902768AA266680SW3ICA2366SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10777372130920AA433443SW3ICA2190SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 14:49:8 on Sun 19 Nov 117.