CBrugiaQ_256


Sequence

>CBrugiaQ_256 (12 EST) Length=1101 GGCACGTTTGAGTGATGAGGCCTCACTTGGACGATGATGCATTACATTATAAAAAAAGACAACAGGAAGCGGAAAATCTT CGAAGGGTTGCATTTTACGGTGTAGCATTATCAACCATAGCTTCATTTATATGCGCAATTTCCGTACCAATGTTTTATAA TTATTTGCAACATGTACAATCTGTTATGCAAAATGAAGTGGACTTTTGTAAATCACGCTCAAGTAATATTTGGCGTGAAG TAACACGAACACAGGTATTATCAAAAGTAAATGGTGAATTACGGAGCCGTAGGCAAGCCGGTTATGACAGCTATTCGACC AGTGAGGACATACGTGGTGCTGGTGTCAGTGGTGGTATTATGACAAGTTTTGGTGGAGTTACGGGTGCACCTTCTGCACC TGGTGGTGGTTGCTGCGGTTGTGGTGTATCACCACCTGGGCCACCTGGTGAGCCTGGTCCAGATGGAAGTGATGGTGCTG ATGGTGAACCAGGACCACCAGGTAAAGATGGAGAGGATGCACCACAGGAACCACCTACGCAACCTCATATTGAATGGTGT TTCGATTGTCCAGATGCACCAGCCGGTCCAGCAGGAAATCCAGGACCGAAAGGTCCAAAGGGTAAACCTGGACCACCAGG AAAGGATGCAGATGGTGGTAATAGAGGACCACCAGGACTGCCAGGTGAACCAGGACCAAATGGCGCACCAGGTCAAGCAG GTCCAAAAGGACAACCAGGAGTGCCTGGAACTGTGATTGAAAAAACTCTACCACCAGGTCCACCAGGACCACAAGGGCCA CCTGGTCAACCCGGTACACAAGGACCAGCTGGACCGAAAGGTAATCCTGGACAAGATGGACAACCAGGACCACAAGGTGA TATAGGAAAAGATGGAGCACCTGGTAAACCAGGTAGCGATGGAATAACTGGACCACAAGGAGAACGTGGTTCTTCCGGTT CATGCGATCATTGTCCACCACCACGAACAGCACCTGGCTATTAACACATATCATTTGATATAATATGCTACACCGATGAT CTTTGCATAAATCTTTACATTTTACGCATTCCGTCTCCTGATAAACTTGAAATTTTCCTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_256: (12 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4447171167614N43232SW3ICA596SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4450391172421N43538SW3ICA890SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4811711237141N74832SW3ICA1366SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7061551592573AA072487SW3ICA1500SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8983981893003AA257273MBAFCZ1A5T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10483582065005AA406987MBAFCZ7H12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12617472392943AA585531SW3D9CA109SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12617612392957AA585545SW3D9CA128SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12617662392962AA585550SW3D9CA139SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12617812392977AA585565SW3D9CA161SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12618962393092AA585680SW3D9CA443SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13870642663004AA680999SW3D9CA519SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 1:20:36 on Mon 20 Nov 117.