CBrugiaQ_2572


Sequence

>CBrugiaQ_2572 (4 EST) Length=393 CAATATGTTAAAATAAGTAAAAATATTACTCATTTATTACTTATCAGGGGATTTTTGTTATTATAATTTGAGATTTCTCT CTTATAATCACCTGATGGGTATTTCATCCAATTAATTATTGTTTGTTTTAATCATCATCAAATAATTCCTTATCAAACAA ACAAAATTAGTCGCATAAAAAATTTTGTTTGAATGAAAATTATTTGATAAATAACAAACAAAAATTAATATAAATGGAAA AATTATTACTTTTAATTGACCCTCAACCAGACGTACCATCGGGAATCAACCCGATGGTGCAATGTGCGTTCGAAATCTTT GTGCTCAATGCGTCTGCAATTCGCACTATTTATCGCAGCTAGCTGCGTTCTTCATCGATCCACGAGCCAAGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_2572: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7523781668362AA114452MBAFCE5F08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11938582315010AA547809MB3D6V1B09T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13666352605173AA661129MB3D6V3A08T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13666652605203AA661159MB3D6V3E03T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 19:15:30 on Thu 23 Nov 117.