CBrugiaQ_258


Sequence

>CBrugiaQ_258 (2 EST) Length=652 GAAAGAAGCAGAACAGGAATGATGTTCTCAGCGATCCGATCAGTAGTTTCTGCTACATGCAGTCGGACATTGTATGTGCG GCCTGCAGATAGCTTTCTGTTGGGTGTTACTCCCAAATGCAAATCTGATGGTGTCAAAGGGACAGTTATTGGCATCGACC TCGGAACAACTAATTCATGTGTTGCAGGTATGGAAGGGAAACAAACTGAAGTGATTGANAACGCGGAAGGTATTAGGACG ACGCCATCAGTGATTGCATTTACCACACGACGGACAAAGATAAGGTGGCGCACCAGCAAGAGNCGACAAGGAGTTACACA ATTCANNTAATNCACTTGANGCTACCNANCGANTAATTGGACGGNGTTNCGANGATCCGGAANTGCAAAAAGATGTAAAA GTGGTTCCGTTNAAAATTGTTCGCGCATCTAATGGTGATGCTTGGGTTGATGCACAAGGCGTAATGTATTCTCCATCTCA AGTTGGTGCNNACATTTTGATGAAAATGAAAGACCAGCAGAAGAGTTAATTGGGTACAACTGTTCACAATGCTGTTGTCA CAGTTCCAACATATTTCAATGATCTCAGAAACAGCCATCAAAGATGCAGGGTAAATTTGCTGGTTTGAATGTATTGCCGT GTCATTAACGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_258: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4448551167752N43354SWMFCA369SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8675271849757AA228199SWMFCA1123SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:49:49 on Sat 25 Nov 117.