CBrugiaQ_2582


Sequence

>CBrugiaQ_2582 (2 EST) Length=384 GTTTTGCAGTACTGATTAATGGTATTAATTGAAGAAGTCGTTGAAAATACTAGGAAATTAACAGATTCTGCAATATACAC AAAGAAAGATAAGTGGTTGAAAAGACAAAAAGTAGCAGAGAAGGTTCCATCTGATAAGATGGTTCTAGAAGAGAATAAGT TCACTGAGAAGCAACTTAGACGGGATGGTTTTGCTAACCGAATAGGGAAAAGCAAAAGGAAAAAGCTGAGGAAAGATGAA ACTCTTACAAACAAGAAAGAGCCTGTTACAGAGACCAAAAATGCTAACCAGATTATTCAGAAGATTCAAGGAAATGTGAG TCCTAAGGCTGTTAAAAGGAAAAGAAAGCAATCTATGGAAGAGGAAAAGAATGTCTCAACCACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2582: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8809781870962AA241670MBL2SJ8A10T3Brugia malayi second stage larvae JHU96SL-BmL2
8981751892780AA257258MB4SLM1A12T3Brugia malayi L4 JHU93SL-BmL4


Date: 2:26:50 on Wed 22 Nov 117.