CBrugiaQ_26


Sequence

>CBrugiaQ_26 (17 EST) Length=892 TGGACCGGATTCATTTGTGGGAATTGGCATTGCCCATTTTTGTGTGGGAAGGAGAAATTACCCTTGGCACAAGTTTGGGA GTTTCCGTTCCGTAGAACGATTCAATTTACGGACGCAGTTCCGTACGGNNATTAAANTCGGGNTGGCCACCAGGTGGGAT TTCAACAAATTAAGTTNTCAATTGGAAGCAAATGAACACCAGGGTATTTCGAAAAGTTTAACAACACCCTTATCCTGATT GAACACAACAAGGGGACCCAATTAGTTTGTAGGGACGGTTGNGTCCTTTCCCCTTACCAGCACGGTTACGTTTCGAGTTG TAAANTTTTTCGATATCAGCCCAAAAATGTGAACGACGAAGAAATGAAACAGCTTCTTTTGTCTTCTGGAAGCTCTCCAC CTTATCAACAACAACAAATGGGACTTCAGGTATTTGTTCAATGATGTGTCCACGAGCTTGCACGAGAGCTGGAATACCCG AAGCAGCTATTGCTGAAACCATAGCATAACGTTTTTGTGCAACATTAACACGACGATGCCAACGTCGGAATACCTTAGTC GGTGCAAACATACGTCCACCACGGCACATGTTACCAAATGCACCCTGTCCAGAACGATGCGTACCACCACTTCGTACACG CGGAATTCTAGCTACCGCACGACCTGTACCCCATGATTCAGCCGAAGTTTGATGCCCAGCTTCAACTGAGACGGCATATG GCTGGCGTTTGTTCTTCCTTATTTGATCGTGTACAAAGGAAACAATATCTGGACGTAACGGTGCGCGAAAAACGCCGGGT AGCCTGATCTGAGTATCGGTCGGTTCGCTTTTATCATTATAGACGGTTACCAATGGGCGGGCACTCATAGCACCTCTCTC AAACGGCACGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_26: (17 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4411371162907N39687SWMFCA257SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4450261172408N43525SW3ICA876SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4706341215765N64883SW3ICA1348SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8675411849771AA228213SWMFCA1143SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8713751855031AA231990SWMFCA1387SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8809941870978AA241712MBL2SJ8C6T3Brugia malayi second stage larvae JHU96SL-BmL2
8855001876904AA246096SWMFCA1553SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8855291876933AA246125SWMFCA1589SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8981201892725AA257197SWMFCA1488SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8981601892765AA257237SWMFCA1542SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9140771912001AA273066SWMFCA1867SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11160322199173AA471409MBAFCX2B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539772247191AA509314MBAFCX9H01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12212512344745AA570855SWMFCA2619SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12212522344746AA570856SWMFCA2620SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12354512369546AA584993SWMFCA2814SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12617272392923AA585511SW3D9CA058SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 18:40:13 on Sat 18 Nov 117.