CBrugiaQ_2605


Sequence

>CBrugiaQ_2605 (3 EST) Length=531 GTTTGAGAGATCATCGAACTTTATACGTTGGAGATAGTGTTGGTCGCGTTTGGAGCTGGCAGATTGGTGATGAAGTTGGT ACACGCGCAGACCACTGGGTACAAGACCCAAGTAGAAGTACTTGTACACAATGCATGCAAAAGTTCTCGCTTGCCGAAAG GCGACATCACTGTCGAAATTGTGGACATATCTTTTGCAGTCGGTGTAGTCGATTTGAAACCGACATAAAACACATGAAAA TTTCAAAGCCAGTGCGTGTTTGCCAGAGTTGCTTTCTGCGCCTAAAGGCAGAAGGGGTTTCCTGAAAAGGAAGAGACATG AAAAAGAAAGGACTTCCTCCTGTTTCTCTGCTCCTGTTGGCATGTTGTAACTTATTATTACCAGCTTATTTAAAATATTT TTAATAAGTAGCAGTTTTCTAAGGATATTCTCTTCGATCTCAGTCTTATAATCCGTTTGGTGTAATGTTGTGGTTTAATC CTTTATTTCCATTTCCACCAACGTTCTTTGCATAATAAACTGATTTGACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_2605: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217607808429R47542SW3ICA109SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5801071382108W59894SWAMCA772SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11537942247008AA509131MBAFCX7F07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 7:20:15 on Mon 20 Nov 117.