CBrugiaQ_262


Sequence

>CBrugiaQ_262 (2 EST) Length=1041 TTTGAGGTGAAAAGAACAAGAAAACAATCAATCAATCGATATTGCTAATATATATTTTTTCTTTAACAAAGCGAAATTTC TTCAATACAATTATCTGTTGTTGACATAGCAATATGATTGGTAATTGTGAAAGCGATGAACTGATGGTAATCATAAGAAT GATTTTGCAATTCTATGCTATCAGTTAAAAGTTTTGCTCGTTGATAAGTGATAAGAAAGAGCATATAAAATGCCACCAAT AGCTGCCGCACGATCTGGTCAAAATATTCGCCGTACATGTAAATTAATGAATGACATTTCAACTTCACCAACAACGGCAA CTAAAATACCAGCAACAACTATAGCAGCAACAATAACAACAACAACAATAACAACTGCACCACCACCAACAACAACAACA ACAACAGCAACAGTAGCAGCAAAAACAACAACAACGACAAAAGCATATGGTTCAGGAAAGAATGTGCAAAAAGTCATTTC ATCACATTTAAAAAATTCAAGATTATATAAAACTGAACTCTGTCGAACATGGGTGGATTGTGGACGAAGTAATTATGGTG ATAAATGTCAGTATGCTCACGGTGAAGGAAAAAGAAAGCCAGTACAAAGGCATCGCAAATATAAAACTGAATTTTGTTTA TCGTTCCATCAAGTTGGTTATCCTCCATATGGACCGAGGTGTAATTTCATTCATAATGAAGAGCAATCACAAATTGGACG TAATCAAATTAATTGCAATGGAAACAATAAGATGAATGTTAGTAATTGTAGCAGCAATAATAGTAACAATGATCTAACAG CAACAACAACAACAACAGCAACAGTAACACCAACAGCAGCAGCAGCAGGAGCAGCAACAATAACAGCTGTTACAGCAACA GCTACTACAACATTAACATTTGGTATTTGGCAACCATATTGTAATTCAATGGGTGATTCACCAGCTCCTAGTTCAGCTTG TTCCAGTACTGATAGCTCTATTGGTTCACAAGTCCAAGTGTAGATTTTGATGAGAATATTGCTCTGCTATTGTTGCAACT A


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CBrugiaQ_262: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8679321850697AA228574SWMFCA1294SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8855111876915AA246107SWMFCA1565SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:38:1 on Thu 23 Nov 117.