CBrugiaQ_2620


Sequence

>CBrugiaQ_2620 (2 EST) Length=355 CAATCCTCATTTGCGCATTTCTGTTGAATCGAAATGCTAATTAAAATCGCGATATTGCTAATAGCATTCGAGCAAAGCCT ACCACAGGTTGCTGGCCAATGCTGTTGTCCAGGTGCGCAATCGTCATCCCTCTTCCCATTCCCATTTTTGCCAGATTATT CATGGTTATTGCCACATCCGACGTTTGGAGAAGACAAAAAGGAATGCGGGGGTTGTTGTTGTGGATGCTGTAAATGTGGT GGTGGATGAAAAGAACGCTGTGAAAAATGAAACTATCGAAGTTTTTGAATTGTTGCAATGCTAATGTATGAGTGATATGA TGTTTGACAAGATTAAACTATTGTTTAACTTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_2620: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12618062393002AA585590SW3D9CA265SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12618702393066AA585654SW3D9CA403SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 8:28:51 on Fri 24 Nov 117.