CBrugiaQ_2625


Sequence

>CBrugiaQ_2625 (2 EST) Length=412 GCCAATACAGGCGACAGGTAATGAGAGATNAGTAGTTGACAAATGAAGTTTTAGGGCATAGACAACAAGTGACGACATTC GGCACGAGCAGATTCTGTGCAAAGGTCAATCAGGAAACTCTCCAAGTAAGTAGGAAGAATTTGTTCCGGATATGTGGTAC TATTGTGGTCGCAGAAATAGTGCTTGCTGCGTATGTTGAATATGGTGTACGATTTCCACATGAGGTTTTCTCGAGAATTT GCTGATTTCGCAGTGGGCAACAAATATGGCGCTAAAACTTCTCGTCATATTGGTGGCAAGTAAAAGATCAGAACTGATTA AATTTGGAATTATGTTACATTTCTTCCAATGCAGCTTCTAATATAAATTGATTGGTTGTGAAGCATTGGAGTTCAAATAA AAAGAAAAAGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_2625: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7271841634829AA089350SWAFCA46SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
7523961668380AA114484MBAFCE6A02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:49:20 on Fri 24 Nov 117.