CBrugiaQ_263


Sequence

>CBrugiaQ_263 (2 EST) Length=1128 CCAATTCCAACGAGTTTTTCGGTTTCCAAGGCATTTTGTCTTGGAGCATTGCTCGTTTCAACCATGGGGATAAAGGGATT ATCCATCGGACTGTTCAATAGTTCTTCATTATCAAATTTGTCAATTAATTCACTGATAACATTTGGCACCAGTTCTCATA TATTCATTTATAATTCTTCGTAGTTTCAGCTCCATTTAAAGCGCCATGCACTTTTTCTAACAGAATGCAAAAGAGCTTCT TGGAATGCAATTTTCTTCCAAACTCTCGACTTCTGTTATGGTGCTCAATTGAATAGTTGTAATACTGCACACATTGTCAA ATATTAAAGTTAAATTTTTGAATGGTGTTTTCCAATTTGCTAACTGAATTTCCAGATCTTGAGTGAATATTAGATTTTCG TCAATTGAGATATGATTTTTTAAACGCATGCAAAGCTGCTCACATTTTTGTACCCATATTAACACTGATTCCATATATTC ATTAGTATTACTCTTAGTAGCATGTGATGAAAGCGTAAAAATAACACGTTGCACATTAATTTTTACCCAAAATAATCCTT GAAGATATTGTAAACAAATATCCAAAAATAATTGCTTCACATCATACCATTCTCGTGAAAAGTAAACTCGTGCCGAATTC GGCACGAGATTTTGTCGAGTATTTGACTACTTCAGTTAAACATCTCTACATTTTTTGCCGATCAAAAACAAATGAATAGA AACGAAAGTGCTATTGAGAAAAAGAGCAAGAATGAGGGGATGAGAAGAAAATGAGAATAGGTACAGAAGGTTGAGCTGTG AGGGGACTGTTCGCTGAAAAAAGTTGTGAAATTCTTTGGAGTAAAGAATTCGAATTGTATGAGTTAATCCGTCATTCTGC TCCGCTCTTTGAAATTTAGAATGCAGTTTGTTCCTTTTAGTTTGAATTCAAAGAATGTCATTATGGAAATTGCAATTTCT CGCCTATGAATTAAAAAATTTGTTCCACAGGACGAGAGTGAGAATAAATTGTGTTGTAATATGATCATTGATATATCATA TCATCAGAAATCTATTAATTGGTTAGAAGTCCTACTAACTTCTTTATAATTACTGTTTCAAATTGTTTGATAAATCCATT GAATTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_263: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7522761668260AA114377MBAFCE3D05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12212902345187AA570894SWMFCA2666SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 18:26:19 on Sat 18 Nov 117.