CBrugiaQ_2641


Sequence

>CBrugiaQ_2641 (4 EST) Length=355 GCTCTAGAGGCTTCTGGATCCCACGGGCTGCAGGATTTCGAAACGGAAGCAGCGGCGGAGCAAGCTGTTGGAAGTATGAA CCATGCGGAATTTATGGGACGTCAGCTTCGTGTCGATCGTGCTATTTCTCGATGAATGTTTTCAGCAGCTCTGGGCGTAC ACCTATTGTTTTGTTGTAATCGTCCCGTTTCAAATGTTCTTTTGCAACTCGGTTACTCTTACATTGGTGTAATTACAGTG TTGACGTATCCCGTGGCAGTTTATTTTTTTGTCACATCTTTGATTCTCTTTCCAGTACAAATGTGACTTCCCTGTTTTGA GGCGTATTTTCAGAAATAAAGAATTACATTTTAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_2641: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8808431870827AA241478MBL2SJ0C6T3Brugia malayi second stage larvae JHU96SL-BmL2
8808501870834AA241516MBL2SJ0D3T3Brugia malayi second stage larvae JHU96SL-BmL2
8987901893395AA257879MBL2SJ4G2T3Brugia malayi second stage larvae JHU96SL-BmL2
11888252289689AA542777MBL2SK3D06T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 11:37:55 on Fri 24 Nov 117.