CBrugiaQ_2646


Sequence

>CBrugiaQ_2646 (2 EST) Length=496 AGCAGTACNACNAAATCATATTATCATGCTAAAAAATCAAATGCCATCTACACCAGCATTATTAACAGTAATAATGATGA TAATTNATGGTGGTGTGGAAGTAGTGAAATGTTTAGAAATGTTTGAAAATGANCCCGAGAATGTTGATCGAGANATTCGA ACATTGTGCAGTCTTANTCCAACTTTTANTATTTGTGCTGAGCAAGCTATGGATAAACGAAAGTCAAGCTATATGCGCTT CGGACGATCATATCCTGCTATTCTAGAAACTGAACCACATTTGAGTGAGAAGCGAAAGAGTGCATATATGAGATTTGGGA AAACGTTATGTAGATTTCAATGATTATGTTAAAAGAAAATCAGCATATATGCGATTTGGTCGTTAGGAGGAAAAAAATGA AGAAATATAAATTCAAATTTTCTTCTTACACAATTATTTTGTTTACATAACATTATATTTCCATAATGTTTTCTTATGTT TAAACAGAATTATCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_2646: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291572902104H30948SW3ICA169SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8557961817199AA216495AS4SLC657T3Brugia malayi L4 JHU93SL-BmL4


Date: 11:53:0 on Fri 24 Nov 117.