CBrugiaQ_2648


Sequence

>CBrugiaQ_2648 (2 EST) Length=352 GGAAAGATTATGCAGAAATGGAACAAGAAAAATATCCACGAGCTCATATCGAGATTTGTGAGTGCAACTTAGGACGATTT CCCCAGGCGGAAGCGTTTGTCAAATCCAATATGGTAAAGAAGTGGGGAACTTGTGTGAAAGTTCATCACGTTCGAGGAAC ATTACCGACAATTAAGTTATTAGATGCTCAAGGAGAAGTGCAAAAGACCATGAATATCGAAAAATGGGATACCGATACAA TTACGGAATTTCTGAATACATGGCTGGAGTGCTAGTGATCTAGTGATCAGCATCATCTGTCAATATGTCCTTTTTAGTTC CAACTCTTGTATGAAATCTAATATTTCTCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2648: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8982901892895AA257328MB4SLM2F11T3Brugia malayi L4 JHU93SL-BmL4
11887582289622AA542710MB4SLY2D04T3Brugia malayi L4 JHU93SL-BmL4


Date: 19:50:4 on Mon 20 Nov 117.