CBrugiaQ_267


Sequence

>CBrugiaQ_267 (3 EST) Length=647 TTTGAGTGGTAGCAGCATAAGTAATGGNAACTGGTGATGATATCCCGACGTTTAAGCTTGTGCTTGTTGGTGATGGCGGT ACAGGCAAGACGACATTTGTCAAGAGGNATCTTACAGGAGAGTTTGAGAAGAAATACGTTGCAACTTTGGGTGTGGAAGT TCATCCACTGATATTTCACACAAACAGAGGTCAGATTCGATTTAATGTTTGGGATACAGCTGGACAAGAGAAATTTGGGC GGATTGCGAGATGGTTATTACATACAAGGTCAGTGCGCTATAATTATGTTCGATGTAACAGCACGTGTTACTTACAAAAA CGTTCCAAACTGGCATCGTGATTTAGTGCGCGTGTGTGAAAATATCCCGATAGTTTTATGTGGGAATAAGGTAGATGTTG AAAGACAGAAAAGTCAAAGCTAAGACGATCACATTCCACCGAAAGAAGAATCTGCAGTACTACGATATCTCAGCGAAGAA GCAATTATAATTTCGAAAAACCTTTCTATGGCTGGCCCGAAAATTGTTAGGCGATCCAATCTAGAATTTGTTGCATGCTG CACTGCTCTCCTGAGTGCAGATGATCCACAATGTGCACAGTATGACAGAATGCTCTGCTGCACGCTGACTTCCGACGAGA TGAGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_267: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5123341278117W05384RRAMCA119SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5251781293884W18210SWAMCA657SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6676561537136AA051908SWMFCA867SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 6:56:26 on Mon 20 Nov 117.