CBrugiaQ_2674


Sequence

>CBrugiaQ_2674 (20 EST) Length=338 AACAGTGCTGTTAACAATTTACTGGTATATAACAAAAAAACAATCAAGCAATCATAAAATTAATCTGTATTAAGCTTTAG ATTCCTTCTTTTGATGCTGATGACGCTTGTTATGCTTCTTAGCAAATCGAAGATTCCGCAGAAACTTCTGGTCAACTCCT TTCATGGACATGAAACGATGTTTCTTCGGTTTCTTAATACCATTCCTGTGATCTTTTCTATTTTGATTATGACTTGTATG ATTCTTTGATTTTGCCATACTGATTTTTATTATTTGACTAGTTTTTCTCAAACTGGGGAAAGCATCCGTATCCCGGAAAT TTAACAGAAAACCCAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2674: (20 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320168944784R86378SW3ICA327SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4448971172279N43396AS4SLC517T3Brugia malayi L4 JHU93SL-BmL4
4449221172304N43421AS4SLC523T3Brugia malayi L4 JHU93SL-BmL4
8001611737544AA161712MBAFCE9F12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8558041817207AA216467AS4SLC723T3Brugia malayi L4 JHU93SL-BmL4
8678991850664AA228557KJ4SLB422T3JHU93SL-BmL4 (JHU)
8810491871033AA241434MBL2SJ8H8T3Brugia malayi second stage larvae JHU96SL-BmL2
8982351892840AA257364MB4SLM2A4T3Brugia malayi L4 JHU93SL-BmL4
8986811893286AA257796MBL2SJ3C11T3Brugia malayi second stage larvae JHU96SL-BmL2
8986881893293AA257803MBL2SJ3D6T3Brugia malayi second stage larvae JHU96SL-BmL2
8987301893335AA257819MBL2SJ3H8T3Brugia malayi second stage larvae JHU96SL-BmL2
8987361893341AA257825MBL2SJ4A2T3Brugia malayi second stage larvae JHU96SL-BmL2
8987551893360AA257844MBL2SJ4B10T3Brugia malayi second stage larvae JHU96SL-BmL2
8987581893363AA257847MBL2SJ4C2T3Brugia malayi second stage larvae JHU96SL-BmL2
8987881893393AA257877MBL2SJ4F11T3Brugia malayi second stage larvae JHU96SL-BmL2
9101221906187AA269125KJ4SLB149T3JHU93SL-BmL4 (JHU)
9164271917047AA275412MB4SLY1C04T3Brugia malayi L4 JHU93SL-BmL4
9164491917069AA275434MB4SLY1E03T3Brugia malayi L4 JHU93SL-BmL4
11939182315070AA547869MB3D6V2B04T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13814722655592AA675886MBAFCW5H12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 17:20:17 on Fri 24 Nov 117.