CBrugiaQ_268


Sequence

>CBrugiaQ_268 (3 EST) Length=738 GGAAAGCATGTATTGGAGCAAGGATAAACAGGGGCATTGGTTAGGAGCGGAAACAACCGTCAGTTTTGGAAATTCGGACC TTCAGTAACATCAGTTTCAAAAGTTGTTTTTTCAGTTTCGGAAGTTTTTTCAGTTTATCAGTATCAAAAGCTTCAGTTTC GGGAAGTTTCTTCAGTTTCATCAGTTTCATACGTTCAGTTTCTGTAATGCTTGGTTCTTCCGTCGTTATTTCAGGTTTTC TGACTCGCCTTCAAGCTCACTGCTGATAGCATTTAACAATGGATAAGGACCTTTGCCACAGCTTTTACCCGTGAAATCAT CGAAATCAAGAGCCCATATGAAGGCACCACCATATCCTTTCTCTTTAAGCCATTTCATTTTAATTCTGATAGTTTCCTCG TTATCATAACCATACCATTGGTCTCCTTTTACCATGTATGCCCCGACACCTTCTTGATGAACCGTTTCCTTGCCACCTTC TTTCAGATATTTGCATATCTCCCAGTAAGATGCAGTACCACCAGCAGGATTTGTTTTCGATGCTGACGACGGACGACTAG CCGGTGCTCCAATCGCTGTTTCCGAAGGATTATCTAATGTCCATCCCTGAGCGTACATCGGAATTCCAATGATAATTTTC TCTTTCGGCATACCCTTACTTGCCCAATAGTCCGCAGCAAATTCAGTATTAAATATGCCAATTCCAGAAACTTCTCCCTT TGTTGGATGCAATTTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CBrugiaQ_268: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6364351486200AA022418SWMFCA583SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8855151876919AA246111SWMFCA1573SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8987411893346AA257830MBL2SJ4A7T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 9:42:1 on Thu 23 Nov 117.