CBrugiaQ_2682


Sequence

>CBrugiaQ_2682 (5 EST) Length=349 GATTTCTTAACAGTTTTACCAGTGGCAGGGATGACGGAGACGGAATGGAACGCCAAGTAGTTGTAAGAAATTGGACGTTC AGGTATTCAGGGAAATTTTTGTTACAATTGTAGGCATTAGTATTATTATGTCAACGAAACATTTGCGACGATATTTACAA GGAAAAAAGGCAACTGGAGAGGAGAACTTATTAGTCCAACAAAAGGAGGAGAGCTCCGAATCGGCAAATGAAGAAGGAAA GTCGGAAGCATTTGTGTGCAATAGATATAAATTCCTCGAGGAANCCGGGGAACCCGGTACCCAATTCGCCCTATAGTGAG TCGTATTACCAGTAGAGAACATTCCGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2682: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
343563973967R95237SW3ICA399SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
6825991549427AA056797SWAMCA1532SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7244821631392AA088165SWAFCA035SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
8679931850758AA228652SW3ICA2062SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8987191893324AA257808MBL2SJ3G8T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 8:13:1 on Thu 23 Nov 117.