CBrugiaQ_2686


Sequence

>CBrugiaQ_2686 (2 EST) Length=349 TAAAGTGCCCTGGTTGTTACAAAATTACAACGGTATTCAGTCATGCTCAATCCGTAGTAGTTTGTGTTGGATGTAATACG GTACTTTGTCAACCAACCGGTGGTAAAGCCCATCTAACAGAAGGAATGTTCTTTTCGGAAAAAGCAGCATTAAACATCAA AATTGTTTCTGTTGTTTCATCTTGGAAGTATTATTTAGTATAACTTGTGAATTGTTATCACATCGTTTAAGTTGTTTCAC GGTGATTAAGCAATAGAAGTTATTTACACTAAGGGTCTAATCATTAGAGTGAATTTTGTCCATGTTAGGAATTGAATTCT GGTATAAAGTTACAAAGCCCTATGGGTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2686: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8808881870872AA241554MBL2SJ0G9T3Brugia malayi second stage larvae JHU96SL-BmL2
8811051871089AA241425MBL2SJ9F2T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 13:41:59 on Mon 20 Nov 117.