CBrugiaQ_2693


Sequence

>CBrugiaQ_2693 (3 EST) Length=366 GGAAATATTAATTATAATAAAACTGATCTGATATGACAAAGTTGTTGGTATATATTGCTTTCATCATTTATTGTGGTGGC CAAGCTGCTAACCGAGGAAGCAGCGAGCACCAAATAATGCAGCAGCCGCGGAGATTATCCACAGATTATAAAGTTGACAA GTTATGGGATGATGGCTCATTAATACAAACAACGCAAGTGGAAGAATCAATGCTATTGAATTGTGATAGAATGAAAGATG GAAGAGTGTCTATTTTGGAAGAGAAACCATTGCTGTTTGTGCGAAACACTCTTAATTTGATAAAGTGAAACTATTAGAAT TGTTAATATGCAAGTGATAAAGGTTGATAATCACAAATTAACACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_2693: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11939402315092AA547891MB3D6V2D06T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
12618592393055AA585643SW3D9CA383SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
12619252393121AA585709SW3D9CA502SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 21:7:13 on Sun 19 Nov 117.