CBrugiaQ_27


Sequence

>CBrugiaQ_27 (7 EST) Length=1084 TTATCAGATAAAGTTCGTTTGGAGTTTTTCGGTTCATCGGATAAAGGTTCGTTTGNANGNTNGTTTCCTTAACAGGAGCC CCGAACCTTTTGGGGACCGTTCCTGNCACTTTTTTCAGAATTGCATTTTCCCAGTAGAGCGTACCACCAGCGGATTGTTT TNGATGNGGAGACGGANGATTACCCGGTGNTCCATTGGTGTTTCGGAGGGATATTTAATGTCCATCCCNGGGCGAACATC GGAATTCCCAAGGATAATTTTTTCTTTCGGCANACCTTAANTGGCCCAATAGTCNGCAGCAAATTCAGTATTAAATATGC CAATTCNGGGAAATTCTCCNTTTGTGGGATGCAATTTTCNGGTAAATCGACGTTNTTNTCCCAACTACNGTGTAAATCGT ATGACATTAGAAATAGGAGATCGAAATTTTTTCNGGAGAGACTCCACATTGTAACTTCCGTCAATAGTTCCCTTCCCGGC GGAAACAGCAGCGGTTAAAAGTAATCGTGGCTAACCAGATGTTTGGGCTTCTTCCACCAAACGCTGTTTTCATTGCCTCA ACAAGTTTAGCGTGTTCCTCAGCAACACCGACTGGATATTCCCAATCCAAATCGAATCCATCAAAATTATTCTTACGGAG AAATGCTATAGCTGATTTAATAAAACGTTCCGTTTTTTGCGCCGACTTCGCTATTCCAGTGAAAATTGCTGATCCGAAGT TGTAGCCACCATAGGAAAGAAGGACTTTCAGTCCTGGGTTCGTTTCTCTCAGTTTCGTCACAGCTGAGTACATTCCTTTC GACCATTCAGTATCTTCATCGTTCCATTCAAAAGGTTTTGAATCACCTAATTCATCGACTTTAGCAAATGCGTAAAGAAT GTGGGTGCATAGTCCATTTGGAATATTTCCAGGCAAGAATTTACCTTCTCCATCTCGATACTGAGCCCAGTTAGTGTAGT AACATCCACGAACATAACCGTGTATAACAGTAATTGTATTACTGAGTATAATGAAAAATAATATTAGCGTAGTCCGATTC ATATCACTTTGCGAAAGCTGTTGTCCACTTCTCGATCAACTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_27: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350173988804H48963SWMFCA010SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4459671182984N44465SWMFCA187SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6363901486155AA022373SWMFCA500SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6806981547261AA054927SWMFCA800SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8855881876992AA246080SWMFCA1672SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10483432064990AA406972MBAFCZ7G06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12774602429602AA598350SWMFCA2991SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 9:9:3 on Tue 21 Nov 117.