CBrugiaQ_2702


Sequence

>CBrugiaQ_2702 (5 EST) Length=865 CCGATTCAACAAAGGCGAAAAGTCCATAATTCATCTCAAAGGCAGCCGTTTCACTTTTGGTGCTACTCCACCTCCAGAAT ATGGTTTACCGCCTCATGCTGAAATTGATTTCACTTTGTTCCTCAAGGAATATGATAAGGTAAAGGCGTCATGGGAATTG ACTGGTGAAGAAAAGCTTGATGCTGCAGAAGCTGCGAAAGAAAGGGGTACTATGTTTTTCAAACAAGGCAAGATGCGCCT TGCAGCTGCAAAATATATGCGCGTTATTGAGTTGTTGGAATATGAAAAATCATTAGAAAATGAAGCCAAAAGCAGACGGG ATGCGCTGTTGCTTGCTGGTTACCTTAACAGCGCCCTCGTATATGCGAAGCAAGATGAAACAGTGGAATGTATAAAGAAT TGTGACAAAGCACTAGAAGTTGATCCGAAATGTGTGAAAGCATTATATCGAAAGGCTTTGGCACTTCAAGAGCAAAACGA TGCTGATGAAGCAATTATTGAGTACAAAAAAGTACTAGAATACGAACCTGACAACAAGGCAGCGATAGCGCAAATAGCGG CATGTAAGAAAAAGTTGGCAGAGATTCGTGAGAAAGAGAAAAAGCGATATAAGGGAATGTTCGAAAGATTTGCTGCTAAA GAAAAGGTTGAAACGAATGAAGATTTGGAAACTGCAAGCCCAAAATCGGAAGTGGTGAATTGAGAAGTAATGGAGTTATT GATTTTTACTGTTCAATTGATCTATTTCACATGCGTTCCTTAAATTTTGAGCGTATTTGTTTCAAAATTATTGGTTACAC TGTTTATTTCACCACTAATAAGTGTTAAATGTCCTTGTTTTGAGCAGATAAAAGCAGTTTTGATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_2702: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7473481660958AA109462MBAFCE2F08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7473491660959AA109463MBAFCE2F09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7524101668394AA114498MBAFCE6B06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8983641892969AA257493MBAFCZ0F3T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13247682539411AA627024MBAFCW2F06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 20:49:39 on Wed 22 Nov 117.