CBrugiaQ_2703


Sequence

>CBrugiaQ_2703 (2 EST) Length=348 CTGAACGGACGTAGAATGACGCAGTCCCATATCTACGAATTACCCATTACGAGACTCTACGTAAAGTATGCGGACGTGGA GGATGGACGCCATGTCAAACGTCACATCAAAAATACAATCAAACATCTGAAATAATATGTTGCGACCAAATATCAAAAGA GTAAAATATTTTATTACGAAGTCAATCAAGAAAGCTGTTATGATCGGGAACTCAAAGAGAAAAAAAAAAATACAATTCCT AAACAAATGAGCTAATTATCAACAACGGTGCTTATTATGGATATAATATGATATGGCTGTAACAGCGTCGTGCGTTTTAT GGTATTAAAAATAAATTCAAAATTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2703: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7484401662311AA110554SW3ICA1596SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8196081763789AA180584MBAFCF7H02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:32:37 on Fri 17 Nov 117.