CBrugiaQ_2710


Sequence

>CBrugiaQ_2710 (3 EST) Length=347 TTATTAACGGAAGGAAAAAGTAATTTTAATTACAAACAATGAAAGTTTAGGATGAAAAGTTAAAATAAATCAAATGTAGT AGGTGAGATTAAACTAATCCAATGCATTTATATTTTATAAAGCTTTATGAGTTGAAGTTGAATCATATTTTTGCTGTGCG ACGGTTAGTTGATGCCTTGGTCCCATGCCCCACTTAGCAAAAACAGTTTTGTCATCTGTTTCAGATACGCAACACCATAA AATACATGTCACTGAGATTATAAATGTTATGGAGAAGAATGAAATCCAAACAGCAATCGGGCCAAGATAGTCTAACATAT CAAGCTGTTGTTTTAAGTCAACCATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2710: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8809171870901AA241609MBL2SJ2B6T3Brugia malayi second stage larvae JHU96SL-BmL2
9141731912543AA273169SW3ICA2597SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11887532289617AA542705MB4SLY2C11T3Brugia malayi L4 JHU93SL-BmL4


Date: 0:25:45 on Thu 23 Nov 117.