CBrugiaQ_2713


Sequence

>CBrugiaQ_2713 (3 EST) Length=328 TAAATTACAGGAAATGTTCTNCCCAATAGGATTTGCTATATCGCTCATTTATTTTGTCTACTGTAATGCAAAAGAGTGCA AAGATGAATCTAACTTTTGTAATATTACGGCAATCGATATTTGCTCTTCAACAAAAACTAACAAATTTNGCCTTGCAACA TGTGGTTTATGTGATGATGATATCACTACTGATAATAATGATATCACTACTGTTACTCCAACTGAAGGCATCCATTTCAT TTCATTACCTTTAAAATTTTAAGATATTTCCTAACTATGAAAAATATTTCTTGTTTATGAAAGTTTAAAATAAAAGATTA TGCATGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2713: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217692808514R47627AS3ISA083SLBrugia malayi infective L3 JHU93SL-BmL3
5061241270751N99336TNPIBM3006Brugia malayi infective L3 JHU93SL-BmL3
10987792167949AA454280RRAMCA434SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 14:58:52 on Sun 19 Nov 117.