CBrugiaQ_2725


Sequence

>CBrugiaQ_2725 (2 EST) Length=345 TAAATTTTTAAAGTTGTCTCAAGCTCCATTCCAAGATATCATTGTATATCCTTGTATTGGATTTTTCTTTGATTTTGCTG TTGAATGATTATGTTGCCTCTTATTAACTCTTAACAACTTAAATTCCTATGTTACATGTAGTACTTCGTTTCCTTTTTGG TTCCTTATTTTTATTTATTTTTTTATTTTTATTTATCAATTCTTGGCATCGTATTTATTGAGTTTTGCATGCTTTCTACA TATTCTCACACCATTTACTCCATCGAAATAATGCTTTTATAAATCATTTGTGTTATTCATTTATATAAGTGGTAGATCCC CTGAATAATAAATAAATAGTTTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2725: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713231854979AA232016SWMFCA1327SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12774452429587AA598394SWMFCA2964SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:45:2 on Fri 24 Nov 117.