CBrugiaQ_2739


Sequence

>CBrugiaQ_2739 (2 EST) Length=348 TGAACATATATTCATCGGTACTAATATTTTCGGGTACAACTGTTATATATGGGTTAGGTTAGTAATTTTGACATACCATA TCTTTTGACATACTGACCATAACTATAATATTATAATATCAGTAATTATGCTATCTAGAAATTGAGAGGAGGGGAAATTA TCATTAGAGAGATATTTTATTTAGGCTATTTTTTCTTCTTTTTTTTTGTATACATTCGGGTTATATGTTATGAACAAATA TTCAATATTTGCTAAAAAATTTTAGCTGAAATATTGTTAGTTTTATGTTGTATGCCTTCCTTCCAATTATTTTTGCGTTG TTTTGAAAATATAACGTTGGTGGTNAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2739: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713361854992AA232029SWMFCA1345SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13870472662987AA680982SWAMCA3206SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:58:38 on Thu 23 Nov 117.