CBrugiaQ_2745


Sequence

>CBrugiaQ_2745 (2 EST) Length=404 TATACGCTTTATTTCCGATNTCGTTTCCCTGTACCACTATCAACGAATACAAATCAGAACGACGGTGTTCGAAAACAGGT TGCAGTTTTCGTACTTCATCGAGATAATTTAATGATATTTCAGCAAAGCATACGTCTATAGTTTCTGAACACTGAGCAAC AACTGCACCCCAAGGATCAACAACCATTGCATGACCATATGATGACCTTTTATCATTATGCTTGCCAGTCTGAGCTGCAG CAACAACATAACACTGCGTTTCGACAGCTCTTGTCCTTAGCAAGATTTCCCAGTGTGCACAACCAGTATCAACAGTGAAA GCCGATGGGTATGTCAAAACATGGGCTCCATTCATACGATACCATAATGCCAATTCAGCAAACCGCAAATCGTAACAAAT GGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2745: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8986101893215AA257647MBAFCZ3D12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813972655517AA675811MBAFCW5B01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:36:48 on Fri 24 Nov 117.