CBrugiaQ_2750


Sequence

>CBrugiaQ_2750 (2 EST) Length=325 TGGGCGATTCGGTAGGTCTCATCTATGCAGGCATTATCATAGTTGGCGGATTCGCTGCGATACTTGAAAGCAGGCAGCAC CGCATCGCTGGCAGCTGGACTTGTTTTTGCGGAGGTATTGAAGGTAGTGGGTGCTCAATCCAACAACAACTCCATGCTTT TAGCCGTTAGTTCTGGCCTTACACTGATAATGGGCGCTCGTTCCATCCAGTCTGGTAAAGTTATGCCTTCTGGAATAGTT GCAATTTGGGAGGTGTGTTTCTACGCCCTTTATCTATGAATTTAACTGAGGATAAATTCATAAAAAATTACATCATAAAT TCTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_2750: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
276419881985H16481AS3ISB274SLBrugia malayi infective L3 JHU93SL-BmL3
4809541235923N74792SW3ICA1402SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 18:43:47 on Sat 18 Nov 117.