CBrugiaQ_2768


Sequence

>CBrugiaQ_2768 (2 EST) Length=323 TGTGAGCTTCCAATTGTGGTTGAGAAATTCTTACTTCTCTCAGTTATCTGAAAATTTAAAAGGAAGAGACGAAGGACGAA ATGTCATCCTCAAAACAAAGTGCTGAAAGCGAATATGAAATCGCTTATCGCTCCACTATTCAGCCGCGTACAGCGGTACG TACTCAGAGCCGACAATCCGGAAACTACAGTAGTGGTACGGTGGTCGGCGGAGGCGGCGGTCGAGTACTAAAAATGGCCA CCGAGATGGGTTCAGCATCTATTGGCGGTATTAGTCCAGCGTTGAGCCCAAATCCCCCAAAATCATTCCTTGAACCAACC GAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2768: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
325133951343R88407TNPIBM3002Brugia malayi infective L3 JHU93SL-BmL3
4447591167656N43274SW3ICA711SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 18:54:12 on Sun 19 Nov 117.