CBrugiaQ_2789


Sequence

>CBrugiaQ_2789 (2 EST) Length=340 TTGAGGTGTTACGCCTGATGGTGTACCGGTGAGCAGCATATCACCTGGTTCCATGGTGACGTATTTTGTTAAAACTTCGA TTAAAGTTGGTATGTCAAAAATCATAGCGTCGGTCCGACAGCACTGCTTCTCTTCATCATTTATACGACAAAATAACACA ACGTCGTGTGGATTGGCGATTTTACTGACATCAATGAAGGATCCTACCGGACATGAGTGGCTCAACAAGTAAGTTGCACG ATGGTTCATTAAAGATGTCGGAACTTAAAAATCGGAACTTTCAGACAGCATTGAAAGACTTTTTTATCTGTGCAAAAGAG TATGATGACAAATGACCTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_2789: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8986771893282AA257792MBL2SJ3C6T3Brugia malayi second stage larvae JHU96SL-BmL2
11538172247031AA509154MBAFCX7H10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 10:53:3 on Tue 21 Nov 117.