CBrugiaQ_2816


Sequence

>CBrugiaQ_2816 (3 EST) Length=467 GTAGGATGCATTTGGGTGGTCCAGATGTTAGGGATGGGGAGGTGTGCTGTGCCGTGACCAAGATGGGACGGATGTGTGGA GTGTTGGGTATGTCGAGCAGAGGAAGGACAGATGGGTCGAGGATTCGCTCGGTGGAGGTTGCTGCTGTGAGTCGACCAAG GTACGTTAAGGAGTGAATGGTAGGACGTCAGTTAGCGCGTACATAGTTCACAGAAATTGCAGAAACACTGGGATCGGTGT TAAGGGCTCTAAGGATTGAAGAGATTGAGTAATCCTCAGAATAGGGTTGAAGACGATCCCTGAGTTATTACGTAGCGTCA CCGTGGAGCAGTGAGACACAGGAACACCCGAGAGATCTGTTACGTTACGAAGTTTGGGTTCAGACCGAATAGAACAGCAG GGGTATCCCGTTTTGAAAAGCTTCCGAAGAAAACTGACTAATTTCAAAGAAATTTCCAAGCCCTGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2816: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8679901850755AA228649SW3ICA2059SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8985631893168AA257691MBAFCZ2H8T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480442064691AA406725MBAFCZ2H08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 13:42:36 on Thu 23 Nov 117.