CBrugiaQ_2817


Sequence

>CBrugiaQ_2817 (2 EST) Length=338 GTTTGAGCTAGATTCCTCCCACTTGTGCAGTTCAAGTTGTCAGATATTGGTGAAGGCATCGCCGAAGTGCAAATTAAAGA ATGGCATGTGAAAGAAGGTGATCATGTGGCACAGTTTGATAACATTTGCGAAGTACAAAGTGACAAGGCATCAGTGACAA TCACCAGCCGTTATGATGGTGTCATAAAAAACTGTACTACGATGTTGAGGATGTAGCGAAAATAGGAACAACCCTTGTGG ATATCGAAGTTGCGGATGTCGGTGGAAATCGTGATGGGAAACTAGAGAGAGAAATGACCACTTCAGATAATGCTCAGGAA GCTAGGAAAATCCTTGCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2817: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8985431893148AA257671MBAFCZ2F12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480242064671AA406679MBAFCZ2F12T3ABrugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 13:14:8 on Wed 22 Nov 117.