CBrugiaQ_2824


Sequence

>CBrugiaQ_2824 (2 EST) Length=390 AGGGATCGAGCACATTGCGATTGATATTGATCGCCATTTCTGTTCAAATTTATGATGAATAAACTCCGCAGAAAACCAGT ATTGGAGTTAACGTTAGGAGGAAATCTTAACGTGGAAGCGAATAGGCCCACTGCTTGGGGCAAATGCGTATCCTTCCAAA TGGCCACAACGGGATTAAGGGCCAAACAAGCAATGCGATTCTTCGCCACACGACTCTTCAAAAGTTCTTCCTTCAGTTTC TTTCGTTTTCGTGACAACCTTCCCCTTTCCTGAGGGTTGTTCAACCATAAAATCACAAATGCTAAAGTTATTGTTGGGGT GTAAAAACATGCAACTGTTCGATGCCAACGACTTACTGCTCTTCTGAGGATATCCACAAGAATTCCTCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_2824: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6826841549512AA056873SWMFCA880SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10481062064753AA406787MBAFCZ4D03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 16:36:47 on Sat 18 Nov 117.