CBrugiaQ_2837


Sequence

>CBrugiaQ_2837 (4 EST) Length=908 TTGGCAAATCCAACTTACGGTGACCTCAACCATTTGGTGTCTGTGACAATGTCGGGAGTAACAACTTGCTTACGTTTCCC TGGACAGTTGAACGCCGATCTCCGTAAACTTGCCGTCAATATGGTACCATTTCCACGGTTGCATTTCTTTATGCCAGGAT TTGCTCCTCTCTCTGCTCGTGATGCTGCTGCTTATCGAGCCCTCAATGTTGCTGAACTTACTCAACAGATGTTTGATGCC AAAAATATGATGGCAGCATGTGATCCGCGTCATGGTCGTTACCTAACCGTAGCTGCCATGTTCCGAGGTAGAATGTCGAT GCGGGAAGTAGACGAGCAAATGATGCAAGTACAGAATAAGAATTCATCGTATTTCGTTGAATGGATTCCAAATAACGTGA AGACAGCTGTTTGCGACATTCCACCACGTGGATTAAAGATGAGCGCAACATTTATTGGAAATACAACAGCTATACAAGAA CTTTTCAAGCGAATTTCCGAACAATTTACTGCCATGTTCCGACGTAAAGCATTCTTGCATTGGTATACTGGCGAAGGTAT GGATGAAATGGAATTCACGGAAGCGGAAAGTAATATGAATGACTTGGTGTCCGAATATCAACAATATCAAGATGCGACGG CTGATGAAGAAGGTGATCTTCAGGAAGGTGAATCGGAATACATTGAACAGGAAGAGTGATGCACAAAGTGTCAGCTTTGT GAAAAAAGAACTTTTACAGTATTTTATTTATCGTCTTTTCCATGTTTTTATGTTGTCACATTTTATTTTGTTACTCGCTT TCGACATATATTAGCAAATTTTAAAGAATTATAGCGACAAATCTCATTGTTGTACTTCTCAATAAATTACGATCCCCAAA AAAAAAAAAAAAAAAAAAAACCCCCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_2837: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7471481660758AA109340MBAFCE0A07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8809481870932AA241666MBL2SJ2E10T3Brugia malayi second stage larvae JHU96SL-BmL2
8810761871060AA241534MBL2SJ9C6T3Brugia malayi second stage larvae JHU96SL-BmL2
12617602392956AA585544SW3D9CA125SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 4:33:14 on Sat 25 Nov 117.