CBrugiaQ_2846


Sequence

>CBrugiaQ_2846 (2 EST) Length=334 GGATTAGTAAGTGCTTCACTGATCACATTGGTACTCGTTTGGATCATTCACTTCGTCATTAAAAAACTCAGAACTATACT GAAGCAAATTAATGCGGTACAGGGACCACCAACTTGGCCACTTATAGGCAATCTACACCAGTTTCATTTCAAACCAGATG AATTCTTCGAACAAGCTCAGGGTATAGCATATATGTTACAAGCACGCGGTGAGCGCATGTGTCGTATTTGGTTCGGTCCC TGTCCATGGATTTTACTGTACGGAGCAGACGAGTGCGAAGCTATTCTTGGAAGTAATAAAATCTTAGACAAACCATTTCA ATATGGCTTTTTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2846: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8985591893164AA257687MBAFCZ2H4T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480402064687AA406695MBAFCZ2H04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 18:12:55 on Fri 17 Nov 117.