CBrugiaQ_2848


Sequence

>CBrugiaQ_2848 (2 EST) Length=334 CACGAGCGCAGTCAACTGCAGATGAAGTTGAAACAACAACAAAATGGTGGAATGATTATCCAACATCGCGTTATATCGAT TTAGCTCGTCCTAAAACGACATTTCAAAATTATATGTCAAATGTTTGGAGTAAACCAAAAGAGCTTGCTCGATCAGCTTC TTATACCAATCTTACATATATTAAGGAAGCAGAACATGATTTTCCAATTCGTCGATCAACATCCGTTTCATTGCTTGCGC CATCTTTAGCATTACCACAACATTATCGTCAAGCAGAACGTGTTATTGATGCAATACCTGTTTATCAGCCAAAAATTTAT AATTGGTATAATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2848: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8985381893143AA257666MBAFCZ2F7T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480192064666AA406674MBAFCZ2F07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 2:49:8 on Sat 25 Nov 117.