CBrugiaQ_2861


Sequence

>CBrugiaQ_2861 (2 EST) Length=338 AAAATAATTTAGTAATGGAAGGCAGTTCAACTCCAACTCCAAGTGCTGGTGGGTCAGCAAAGACTAATAGCATGATCTAC ATTTGTGGAGAATCGTGCACGAATGCGAGAACGAAATCCGTCCAAAGGATGCGATCAGATGTCGAGAATGTGGTTACAGG AAATTGTATAAAAAACGTGGCCGGAAGTGGAATGGTTTATGATGCACGTTGAGAAAAATGGAAACTGCAAAAATATTTTC AAATATGAGATTTATTTTTGCTCATTGTACGTATTTTATGTTATATGTGTACATGTGCTTTACATATTTACAAGTGAAAC ATAAAAGTGTCTATATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2861: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7619411681809AA123638MBAFCE7A06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8811181871102AA241641MBL2SJ9G4T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 14:24:10 on Fri 17 Nov 117.