CBrugiaQ_2875


Sequence

>CBrugiaQ_2875 (49 EST) Length=2312 GGAATGGGACGACGACCAGCAAGATGCTACCGTTATATCAAGAATAAGCCATATCCCAAGTCTCGATTCTGTCGTGGTGT TCCAGATCCGAAAATTCCTATCTTTGATTTGGGCGAATAGAAAGCTACAGTGGATGAATTCCGGGTTTAATTCGGCACCC AAGTTTGAGGGAGGAATTTTTGGGAAGTTCATTTTTGCTTGGTAAAGCAGATTTGTCGAGGAAAAGATGCCGGAAGGTTC ATCGAAGATTGTTGTGCCGGAAGGAAAAGTGCCGGATGAATTGGAAAAGCAAGTATCAAATGCGATCGCCGATTTAGAAA GTAATTCTGATATTCGGGCTCAGCTACGTGAACTTTACATTGTCGGCGCTAAGGAAGTCGATGTGCCAAATGCAAATAAC AAAAAGAGTATCATTGTCTATGTACCCGTACCACAGTTACGACAATTTCAAAAAATTCAACCTCGCCTTGTGCGTGAATT GGAAAAGAAATTTAGTGGCAAGCATGTAGTATTTATTGCAAGGCGGCGTATATTACCAAAGCCTAAGCGCGGTAAGAATA GGAAACCACAGAAACAGAAGCGTCCACGTTCACGTACGCTGACTGCTGTTCATGATGCAATGCTTGCTGACTTGGTATAT CCAGCTGAAGTTTGTTGGACGGAGGATCAGAGTTTGAAATTAGANCGGAAACGTATCCATGAAAGTGCACCNTTGATAAA ATCCACNCAACGAATGTTGAACATAAGGTGGACNCATTTTNNCGGCATCNTACAACATTTGACCGGAAAAANATTGCTTT CGAATTCCCTGAACCTTCACTGTGCTGAAACGATATGGTTTTGAATGGGTTCTTGTTAGAGAATGGGTGACAGAAAATAG TATTTGGATTAAAACTTTGATAAGATGATAATTACTTTAAAAAAAACTTATTTTATAAATTAAATTAGTAATTTGCATGC TAGATATTACTGCCTCATTTTCCAATATTTTCAATATATCATTTTCTCGCTTCTTTCGATGTGCTATATATTCATAAATT TTTTCCAAACCTTTTTCGACAACTGACCCATGTCCTGGATATCTCGTGCCGCTCGTGCCGAATTCGGACACGATGAAGTT ATGAGAGGAAGTGATACCACGATGTCGGTGGAAGAAGCATTCAAAAAATACCAAGTTGTGCCGGATGTTATATCAATGGT TCCTACCAAACTGATCAATGTCGATTATAGTGGTGGTGTTAAGGTGAATCTGGGTAATGAACTTACGCCAACACAGGTGA AAGATGAGCCAAAAGTATCATGGGATGCGGAAGCTAAAAGCTTATACACACTCGTTATGACTGATCCAGATGCACCATCT CGACAAAACCCTAAATTCAGAGAATGGCACCACTGGTTGGTAGCCAATATTCCTGGGCAGGACGTTAGCAAAGGTGATGT GTTTTCCGAGTATATTGGATCGGGTCCACCAAAAGGCACAGGACTTCACCGCTATGTATTCTTGGTTTACAAACAACCGG AGAAAATCGTGGATGTCCAACATGGGCATCTTACTAACAGATCAGGAAAAAATCGCGCAAATTTCAAAATTGCCAAATTT GCAGAAAAACACAAGTTGGGAAATCCAATTGCTGGAAACTTCTACCAGGCTCAGTACGACAATTATGTAGCCAAACTGTA TGAACAATTGAGCGATTGATAGTTTTAATTTGTTTTCACAACAATTAACAAATTTACTTTTTTCTTAAGTCAAATTAACA ATAAAAAATGAAANAATTTTTATCAGAACTTGTCGAAAGATTTCTTAGCTCCTGATGCTTTTAACACTTTCAACACATTG TACCGTACAGTCTTCGACAATGGACGACACTCACCAACCGTTACTATATCTCCCACTGCTATATCCCTGAAGGCCGGAGA ACAATGAACAGACATATTACGATGACGTTTTTCATATCGACGATACTTTTTGATAAAATGCAAATAATCTCGTCGAATTA CTATTGTCCGTTGCATTTTCATTTTTACAACAACACCAGTCAATATACGCCCACGAATCGAAACATTTCCAGTGAACGGA CATTTTTTGTCAATATATGTCCCGGTTATAGCCTCACGCGGTGTTTTGAACCCCAGTCCAACATTTCGAACATAACGTAC ATCTTTCTTCGCTTTCTTACCGATTCCCAAAGTTCGCAGTTTATTGTTCAAAAATACAGTGGGCTGTTTTTGAAAAGCTC TTTCTGTTTGTTCCGCCATCTTTTATGCAGTCTTCCAATTTATCCACAGAATCCAGGAACCCTCAAACTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_2875: (49 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217677808499R47612AS3ISA056SLBrugia malayi infective L3 JHU93SL-BmL3
4448701167767N43369SWMFCA386SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4458921182909N44390SW3ICA1258SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5077011272185W00770SWAMCA573SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5305191300269W23406RRAMCA1295SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5595171345338W51537AS4SLC910T3Brugia malayi L4 JHU93SL-BmL4
5595331345354W51507AS4SLC939T3Brugia malayi L4 JHU93SL-BmL4
6000701416493W91787SWAMCA1038SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6000741416497W91791SWAMCA1042SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6364231486188AA022406SWMFCA568SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7244811631391AA088164SWAFCA034SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
7471681660778AA109294MBAFCE0C10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7522591668243AA114373MBAFCE3A06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7619491681817AA123646MBAFCE7B03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8428431799508AA203765SW3ICA2039SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8679641850729AA228610RRAMCA375SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8808561870840AA241522MBL2SJ0D12T3Brugia malayi second stage larvae JHU96SL-BmL2
8808791870863AA241545MBL2SJ0F11T3Brugia malayi second stage larvae JHU96SL-BmL2
8811351871119AA241455MBL2SJ9H11T3Brugia malayi second stage larvae JHU96SL-BmL2
8982381892843AA257367MB4SLM2A7T3Brugia malayi L4 JHU93SL-BmL4
8983011892906AA257339MB4SLM2H1T3Brugia malayi L4 JHU93SL-BmL4
8984961893101AA257430MBAFCZ2B2T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9100011906066AA268998SWMFCA1733SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9350981941910AA293897SW3ICA2749SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10480762064723AA406757MBAFCZ4A06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10481292064776AA406719MBAFCZ4F04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10481592064806AA406827MBAFCZ5F02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10481932064840AA406861MBAFCZ6A03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10482822064929AA406937MBAFCZ7A09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10483222064969AA406704MBAFCZ7E05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10751842113661AA430865RRAMCA368SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10901962158567AA445902SWMFCA2026SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10987922167962AA454293RRAMCA473SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10987932167963AA454294RRAMCA474SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11160292199170AA471406MBAFCX2B08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11160802199221AA471457MBAFCX2G03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11160872199228AA471464MBAFCX2G10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162722199413AA471649MBAFCX5A05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11536342246848AA508971MBAFCW1G07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11536372246851AA508974MBAFCW1G10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11536942246908AA509031MBAFCX6D11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538702247084AA509207MBAFCX8E11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11918762307118AA545827SWMFCA2326SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12139052334987AA563522SWMFCA2477SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12139202335002AA563537SWMFCA2501SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13247432539386AA626999MBAFCW2C12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13247732539416AA627029MBAFCW2F11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13247822539425AA627038MBAFCW2G10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13870522662992AA680987SW3ICA2688SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 12:42:58 on Sat 18 Nov 117.