CBrugiaQ_2877


Sequence

>CBrugiaQ_2877 (2 EST) Length=331 AGGAAATGTTGGACCACGTGGACCACCAGGCCAACCTGGTGTAAATGGAGAACCAGGATCAGCAGGTGAAGATGGTCCAC GAGGACAACCAGGACCACCAGGACCAGCAGGACAGCAAGGGCCACCAGGTCATCCAGGTGAGGAAGGAGCGAAAGGACGA TGTGATCATTGTCCACCTGCACGATTAGCACCGGGTTATTAAGCAAATTGAAAACCGATTATTCATTTGTTTTCATCACA ATTCAACTTATTGCGATCAACGATACTACACTTTCAATAAACAATCAGACACGGCAAATTTGCATATTAACAATTGGTTA TTGTTTCGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_2877: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9245821926184AA283490SW3ICA2499SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
12618452393041AA585629SW3D9CA355SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 8:17:47 on Wed 22 Nov 117.