CBrugiaQ_2891


Sequence

>CBrugiaQ_2891 (7 EST) Length=331 GTNGACATTCTTACTGTTTATTTTTCATTAATGGAAATGAGAAGAGGTATAAATGAAATAATGACAATGGGTGTTTATGT TCAACATGCGGAAGTATCTCAATAAGAACATCGCATTGAAATTCTAAACGAACTCGGCGACATCAGAAAATATACCGTGC CCGTTCCTTTTTGAATTATCTTCAGCAGGCAATAATTTACTAGACGACTGATTGCCATTAACAGCAACTGGTGGTAGATC TCTCCCAGTGTCACCCTGAGTTCCTTCAGTAAACCAGGCACCATTTATTGGTTTCATACTCTTCTCAATAGGCATACTTG TTATTTTTCTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2891: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8558171817220AA216504MB2SLJ1F01T3Brugia malayi second stage larvae JHU96SL-BmL2
8984781893083AA257607MBAFCZ1H5T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9164751917095AA275460MB4SLY1G06T3Brugia malayi L4 JHU93SL-BmL4
11888102289674AA542762MBL2SK3B04T3Brugia malayi second stage larvae JHU96SL-BmL2
11888352289699AA542787MBL2SK3F01T3Brugia malayi second stage larvae JHU96SL-BmL2
11888392289703AA542791MBL2SK3F09T3Brugia malayi second stage larvae JHU96SL-BmL2
13860652660427AA680479SWAMCA3070SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 19:22:32 on Wed 22 Nov 117.