CBrugiaQ_29


Sequence

>CBrugiaQ_29 (9 EST) Length=888 AATCATTNCNTTGGGGAACANGCGTAAGGGGAGTTNATANATTCCGGGATTTTCAAANTTCAATTCAGACCNTTCAAGNC CTTNATTCNGACCATATATTGTATAACCGGGGATTCATGCCCTTGGCATTTTCAGTTAACCTTCTTTTCCGGAGGTTAAA GTTCATGGGACGTAAGTTAAGTAATGNCCAACAAAATGCATCACAGGAAACGTTTGGATTTGATGCAACACCACGCCATA ACAATTTCGGTTTCTAGTTCTTCAACAGTAGTGCTGGAGTTATCTTAACGTGTGCTTTCTTCGAACATTCAATTGGACGA TCATTTAGATCACTGGTTTCCAATCATTTAACAACGCATTAAAACGCAGCAGGCCTTACAGCCCATACAAAAAGAGGAAT GGCAGCTGAACATACGGCTGGTCTCACAGCAGAATTCCGTCGAAGAACGCGACGACGCAATGTCACCGCACGATTTATAA GTGACTGATTGGTTCGTCGTCGAATCGCTTTGTTGACAAGTCTATTGACAACTTTCATCGTAGTTGCTGCTGAAAGTCCA CCATTTGCAACAGTTTGCTGGCGGTTTCTACGTGTGATTGCTCGTTTGCCCCTCTTAATGTTAGTGCGCTTTGGTACCAC ACGTTTTGTTCCTAACCCTTGCATACCACTATCTTGTTGTCGCTGCTTCGCTTTACGTTCTCTTTTTATTATATCATCCA GCGACATATTAAGCTTATTATCAACAATGCTACCATCCATTGTTCAGCACAAATAGAAAGTTTGCAGAATAATAACTCGC AAAGTGTGTATTCACTAATGAAACCTTGACGTATAATTCACAGTGAAATGCAGGAGCAGACCGCGATAGCACTCTCAAAC TTGTGCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_29: (9 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4448421167739N43341SWMFCA153SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6722901537237AA052059SWMFCA789SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7155421619213AA080304SW3ICA1543SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8675091849739AA228181SWMFCA1071SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8810131870997AA241588MBL2SJ8E2T3Brugia malayi second stage larvae JHU96SL-BmL2
9214771923328AA280467SWMFCA2014SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11919272307169AA545878SWMFCA2427SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12212752345172AA570879SWMFCA2644SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12774382429580AA598387SWMFCA2953SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:33:9 on Tue 21 Nov 117.