CBrugiaQ_290


Sequence

>CBrugiaQ_290 (23 EST) Length=666 TTTGGTAANTTCATTCAATTCAAAAAAGAATTTTTAAAAGGAAAATGGAAGGATTAATATTTCTTCTGTTGGNGTAATNG CATGGCATGGATCATTCATTCAGTCATCCGGAATGGTCAAGCTAGTATCTTTAGTCATCCGGGAAATGGTCCAGCTANGA ACCTTCTTGAGGAATGCTTCATAAGCAACCATTCCTTCTGCATCTTCCGTACCTTTCATTATTTCATCTGCTTCTTCAGC TGACAAACGCTCACCTAAAGCCATCAGTACATGCCTTAATTCTGCTGCCATAATCTTTCCTGATTCTTCTTTATCAAAAA CTTTCAATCCTTCAACAAAATCCTGGAACGTCCCTTGTTCCTTTTCTTTGCTTAATTGTTCATAAATTGGCATCCATTCT TCGAATGTCAAACGTTTTTCACCTTTTCGTTTATACTCAGTTCCACTTGCTTTGACAACCATAGCATTTGTTGGCTTAAG ACCAGCAGCTCGGACAACATCACCAATTTGTGTACCATCAATTTTACCATCCAATTCTTCGTCATATAAGAGAAATATCT CTTTTAATTCAGCTTGTGAAGGCATTTCTTATTTTGATGTATACAATTGAAGAGAATTGTTGATGAACGATAAATATGCG ATCTCNAAACTTGAAATGAAATGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_290: (23 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217655808477R47590AS3ISA014SLBrugia malayi infective L3 JHU93SL-BmL3
217707808529R47642AS3ISB036SLBrugia malayi infective L3 JHU93SL-BmL3
217722808544R47657AS3ISB043SLBrugia malayi infective L3 JHU93SL-BmL3
281229889986H21291AS3ISB344SLBrugia malayi infective L3 JHU93SL-BmL3
281245890002H21307AS3ISB255SLBrugia malayi infective L3 JHU93SL-BmL3
291633902165H31009SW3ICA276SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
296560902915H35865SW3ICA196SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4445901167391N43086SW3ICA1094SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4451191182146N43566SW3ICA979SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4452141182241N43713SW3ICA747SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4458961182913N44394SW3ICA1262SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5304521300202W23348SWAMCA490SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6722201537167AA052002SWAMCA1482SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8558061817209AA216469AS4SLC731T3Brugia malayi L4 JHU93SL-BmL4
8982831892888AA257249MB4SLM2F4T3Brugia malayi L4 JHU93SL-BmL4
9139681911892AA272965SW3ICA2460SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9139781911902AA272975SW3ICA2470SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9164341917054AA275419MB4SLY1C11T3Brugia malayi L4 JHU93SL-BmL4
10750662113543AA430786RRAMCA1446SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10777172130900AA433423SW3ICA2656SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11095542189939AA465055SWAMCA1878SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11887452289609AA542697MB4SLY2C02T3Brugia malayi L4 JHU93SL-BmL4
12652292402600AA588937KJ4SLE015T3JHU93SL-BmL4 (JHU)


Date: 19:22:12 on Sun 19 Nov 117.