CBrugiaQ_291


Sequence

>CBrugiaQ_291 (8 EST) Length=636 GCGGAGGTGGGTGATAAGGATAATGTGGTTCTAGGGATAACTTGGGGAACATCCTAAAACTCAGGGATTTTCATTTCTAT GGGGGATCAGATCTTTCGGAGGATGGATCACTAGCAATTATATTNGCGTCATCCTCCAAATGTACCAAATCANAAAGTGA ANTCAGCTTCATTTTCACTTGTGTAATCGTAATCAATCAATGGATTATGTTCTATCAGAGTCGCATTTACAAGCGGCATA TTACCTTGCAATGGAATACGTCGATCACGTAAATGATTACAAAAATTTTGCGAACATATGCAATGTTTTCCTTTTCCATC TCGTTCCATCCAACATTTTGCATCATTAATTTTGTTTTGTTTACGGTAATGATTCGGAAGATTTAATAAGCAAAATGCTG TTGTCAATAACATATCTTCGCCTTCATACAACAAGCAGGCTTCACCCGTACAATTCTTCGACTTAACACACCGTTCGTTG GACGGTCCGGTGTCATAGCAGTCGTAGCACAGCAGCGACTGTGAGCAGCGGTTCAGCAGCAGAGCGACCAGACCCAGACG TTCCATTACCATCTGCTGCGGTACCGCGGTCCTCCTCTACGCTCGCTCCGCCATCCGGCAACTCCGTCTCTCCTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_291: (8 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4123621122542H98320SW3ICA544SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4425541164702N41104SWMFCA276SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4451051182132N43552SW3ICA837SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4809381235907N74776SW3ICA1380SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4809421235911N74780SW3ICA1384SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7061621592580AA072507SW3ICA1512SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
9100301906095AA269027SWMFCA1825SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9214431923294AA280433SW3ICA2487SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 11:35:46 on Wed 22 Nov 117.