CBrugiaQ_2916


Sequence

>CBrugiaQ_2916 (2 EST) Length=327 AACGAATCTTGACAAATTTGGCAAAGGTGCCGGTAAAAGAACATAGGCTGAACAATATGAGCATAAGCACTCGCATCCAG AAGGTGATACCAGGAAAATAGTTAATTATTGCGTTAGTGGTCAGGAAAAAAGAAAGGGAACTATTGTTGGTAGCACAGTG AAGAAAGACTAAAACTGCAACCTCTCCGTTTCGAGTTGAATAACGGAACATTCCTCATCACACATGCATGTTCGAGGCTT TCAAATAGTGTCTCTTAATGTATTCCCATGTATTTTCACGTTTTAATTACTTTTTAATGATCACTTTTATTTTGTAAAAT CTTTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_2916: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11939742315126AA547925MB3D6V2H03T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
11939752315127AA547926MB3D6V2H04T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 17:14:34 on Wed 22 Nov 117.